GitPedia

Unikmer

A versatile toolkit for k-mers with taxonomic information

From shenwei356·Updated January 23, 2026·View on GitHub·

`unikmer` is a toolkit for nucleic acid [k-mer](https://en.wikipedia.org/wiki/K-mer) analysis, providing functions including set operation k-mers (sketch) optional with TaxIds but without count information. The project is written primarily in Go, distributed under the MIT License license, first published in 2018. Key topics include: difference, golang, intersection, k-mer, kmer.

Latest release: v0.20.0unikmer v0.20.0
June 8, 2024View Changelog →

unikmer: a versatile toolkit for k-mers with taxonomic information

Documents: https://bioinf.shenwei.me/unikmer/

unikmer is a toolkit for nucleic acid k-mer analysis,
providing functions
including set operation k-mers (sketch) optional with
TaxIds but without count information.

K-mers are either encoded (k<=32) or hashed (k<=64, using ntHash v1) into uint64,
and serialized in binary file with extension .unik.

TaxIds can be assigned when counting k-mers from genome sequences,
and LCA (Lowest Common Ancestor) is computed during set opertions
including computing union, intersecton, set difference, unique and
repeated k-mers.

Related projects:

<!-- START doctoc generated TOC please keep comment here to allow auto update --> <!-- DON'T EDIT THIS SECTION, INSTEAD RE-RUN doctoc TO UPDATE -->

Table of Contents

<!-- END doctoc generated TOC please keep comment here to allow auto update -->

Using cases

  • Finding conserved regions in all genomes of a species.
  • Finding species/strain-specific sequences for designing probes/primers.

Installation

  1. Downloading executable binary files.

  2. Via Bioconda Anaconda Cloud downloads

     conda install -c bioconda unikmer
    

Commands

Usages

  1. Counting

     count           Generate k-mers (sketch) from FASTA/Q sequences
    
  2. Information

     info            Information of binary files
     num             Quickly inspect the number of k-mers in binary files
    
  3. Format conversion

     view            Read and output binary format to plain text
     dump            Convert plain k-mer text to binary format
    
     encode          Encode plain k-mer texts to integers
     decode          Decode encoded integers to k-mer texts
     
    
  4. Set operations

     concat          Concatenate multiple binary files without removing duplicates
     inter           Intersection of k-mers in multiple binary files
     common          Find k-mers shared by most of the binary files
     union           Union of k-mers in multiple binary files
     diff            Set difference of k-mers in multiple binary files
    
  5. Split and merge

     sort            Sort k-mers to reduce the file size and accelerate downstream analysis
     split           Split k-mers into sorted chunk files
     tsplit          Split k-mers according to TaxId
     merge           Merge k-mers from sorted chunk files
    
  6. Subset

     head            Extract the first N k-mers
     sample          Sample k-mers from binary files
     grep            Search k-mers from binary files
     filter          Filter out low-complexity k-mers
     rfilter         Filter k-mers by taxonomic rank
    
  7. Searching on genomes

     locate          Locate k-mers in genome
     map             Mapping k-mers back to the genome and extract successive regions/subsequences
    
  8. Misc

     autocompletion  Generate shell autocompletion script
     version         Print version information and check for update
    

Binary file

Go Reference

K-mers (represented in uint64 in RAM ) are serialized in 8-Byte
(or less Bytes for shorter k-mers in compact format,
or much less Bytes for sorted k-mers) arrays and
optionally compressed in gzip format with extension of .unik.
TaxIds are optionally stored next to k-mers with 4 or less bytes.

Compression ratio comparison

No TaxIds stored in this test.

cr.jpg

labelencoded-kmer<sup>a</sup>gzip-compressed<sup>b</sup>compact-format<sup>c</sup>sorted<sup>d</sup>comment
plainplain text
gzipgzipped plain text
unik.defaultgzipped encoded k-mers in fixed-length byte array
unik.compatgzipped encoded k-mers in shorter fixed-length byte array
unik.sortedgzipped sorted encoded k-mers
  • <sup>a</sup> One k-mer is encoded as uint64 and serialized in 8 Bytes.
  • <sup>b</sup> K-mers file is compressed in gzip format by default,
    users can switch on global option -C/--no-compress to output non-compressed file.
  • <sup>c</sup> One k-mer is encoded as uint64 and serialized in 8 Bytes by default.
    However few Bytes are needed for short k-mers, e.g., 4 Bytes are enough for
    15-mers (30 bits). This makes the file more compact with smaller file size,
    controled by global option -c/--compact .
  • <sup>d</sup> One k-mer is encoded as uint64, all k-mers are sorted and compressed
    using varint-GB algorithm.
  • In all test, flag --canonical is ON when running unikmer count.

Quick Start

# memusg is for compute time and RAM usage: https://github.com/shenwei356/memusg


# counting (only keep the canonical k-mers and compact output)
# memusg -t unikmer count -k 23 Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23 --canonical --compact
$ memusg -t unikmer count -k 23 Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23 --canonical --compact
elapsed time: 0.897s
peak rss: 192.41 MB


# counting (only keep the canonical k-mers and sort k-mers)
# memusg -t unikmer count -k 23 Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23.sorted --canonical --sort
$ memusg -t unikmer count -k 23 Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23.sorted --canonical --sort
elapsed time: 1.136s
peak rss: 227.28 MB


# counting and assigning global TaxIds
$ unikmer count -k 23 -K -s Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23.sorted   -t 585057
$ unikmer count -k 23 -K -s Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23.sorted -t 511145
$ unikmer count -k 23 -K -s A.muciniphila-ATCC_BAA-835.fasta.gz -o A.muciniphila-ATCC_BAA-835.fasta.gz.sorted -t 349741

# counting minimizer and ouputting in linear order
$ unikmer count -k 23 -W 5 -H -K -l A.muciniphila-ATCC_BAA-835.fasta.gz -o A.muciniphila-ATCC_BAA-835.fasta.gz.m

# view
$ unikmer view Ecoli-MG1655.fasta.gz.k23.sorted.unik --show-taxid | head -n 3
AAAAAAAAACCATCCAAATCTGG 511145
AAAAAAAAACCGCTAGTATATTC 511145
AAAAAAAAACCTGAAAAAAACGG 511145

# view (hashed k-mers needs original FASTA/Q file)
$ unikmer view --show-code --genome A.muciniphila-ATCC_BAA-835.fasta.gz A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik | head -n 3
CATCCGCCATCTTTGGGGTGTCG 1210726578792
AGCGCAAAATCCCCAAACATGTA 2286899379883
AACTGATTTTTGATGATGACTCC 3542156397282

# find the positions of k-mers
$ unikmer locate -g A.muciniphila-ATCC_BAA-835.fasta.gz A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik | head -n 5
NC_010655.1     2       25      ATCTTATAAAATAACCACATAAC 0       .
NC_010655.1     5       28      TTATAAAATAACCACATAACTTA 0       .
NC_010655.1     6       29      TATAAAATAACCACATAACTTAA 0       .
NC_010655.1     9       32      AAAATAACCACATAACTTAAAAA 0       .
NC_010655.1     13      36      TAACCACATAACTTAAAAAGAAT 0       .

# info
$ unikmer info *.unik -a -j 10
file                                              k  canonical  hashed  scaled  include-taxid  global-taxid  sorted  compact  gzipped  version     number  description
A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik       23  ✓          ✓       ✕       ✕                            ✕       ✕        ✓        v5.0       860,900             
A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik  23  ✓          ✕       ✕       ✕                    349741  ✓       ✕        ✓        v5.0     2,630,905             
Ecoli-IAI39.fasta.gz.k23.sorted.unik             23  ✓          ✕       ✕       ✕                    585057  ✓       ✕        ✓        v5.0     4,902,266             
Ecoli-IAI39.fasta.gz.k23.unik                    23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,902,266             
Ecoli-MG1655.fasta.gz.k23.sorted.unik            23  ✓          ✕       ✕       ✕                    511145  ✓       ✕        ✓        v5.0     4,546,632             
Ecoli-MG1655.fasta.gz.k23.unik                   23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,546,632             


# concat
$ memusg -t unikmer concat *.k23.sorted.unik -o concat.k23 -c
elapsed time: 1.020s
peak rss: 25.86 MB



# union
$ memusg -t unikmer union *.k23.sorted.unik -o union.k23 -s
elapsed time: 3.991s
peak rss: 590.92 MB


# or sorting with limited memory.
# note that taxonomy database need some memory.
$ memusg -t unikmer sort *.k23.sorted.unik -o union2.k23 -u -m 1M
elapsed time: 3.538s
peak rss: 324.2 MB

$ unikmer view -t union.k23.unik | md5sum 
4c038832209278840d4d75944b29219c  -
$ unikmer view -t union2.k23.unik | md5sum 
4c038832209278840d4d75944b29219c  -


# duplicate k-mers
# memusg -t unikmer sort *.k23.sorted.unik -o dup.k23 -d -m 1M # limit memory usage
$ memusg -t unikmer sort *.k23.sorted.unik -o dup.k23 -d
elapsed time: 1.143s
peak rss: 240.18 MB


# intersection
$ memusg -t unikmer inter *.k23.sorted.unik -o inter.k23
elapsed time: 1.481s
peak rss: 399.94 MB


# difference
$ memusg -t unikmer diff -j 10 *.k23.sorted.unik -o diff.k23 -s
elapsed time: 0.793s
peak rss: 338.06 MB


$ ls -lh *.unik
-rw-r--r-- 1 shenwei shenwei 6.6M Sep  9 17:24 A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik
-rw-r--r-- 1 shenwei shenwei 9.5M Sep  9 17:24 A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik
-rw-r--r-- 1 shenwei shenwei  46M Sep  9 17:25 concat.k23.unik
-rw-r--r-- 1 shenwei shenwei 9.2M Sep  9 17:27 diff.k23.unik
-rw-r--r-- 1 shenwei shenwei  11M Sep  9 17:26 dup.k23.unik
-rw-r--r-- 1 shenwei shenwei  18M Sep  9 17:23 Ecoli-IAI39.fasta.gz.k23.sorted.unik
-rw-r--r-- 1 shenwei shenwei  29M Sep  9 17:24 Ecoli-IAI39.fasta.gz.k23.unik
-rw-r--r-- 1 shenwei shenwei  17M Sep  9 17:23 Ecoli-MG1655.fasta.gz.k23.sorted.unik
-rw-r--r-- 1 shenwei shenwei  27M Sep  9 17:25 Ecoli-MG1655.fasta.gz.k23.unik
-rw-r--r-- 1 shenwei shenwei  11M Sep  9 17:27 inter.k23.unik
-rw-r--r-- 1 shenwei shenwei  26M Sep  9 17:26 union2.k23.unik
-rw-r--r-- 1 shenwei shenwei  26M Sep  9 17:25 union.k23.unik

$ unikmer stats *.unik -a -j 10
file                                              k  canonical  hashed  scaled  include-taxid  global-taxid  sorted  compact  gzipped  version     number  description
A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik       23  ✓          ✓       ✕       ✕                            ✕       ✕        ✓        v5.0       860,900             
A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik  23  ✓          ✕       ✕       ✕                    349741  ✓       ✕        ✓        v5.0     2,630,905             
concat.k23.unik                                  23  ✓          ✕       ✕       ✓                            ✕       ✓        ✓        v5.0            -1             
diff.k23.unik                                    23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     2,326,096             
dup.k23.unik                                     23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     2,576,170             
Ecoli-IAI39.fasta.gz.k23.sorted.unik             23  ✓          ✕       ✕       ✕                    585057  ✓       ✕        ✓        v5.0     4,902,266             
Ecoli-IAI39.fasta.gz.k23.unik                    23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,902,266             
Ecoli-MG1655.fasta.gz.k23.sorted.unik            23  ✓          ✕       ✕       ✕                    511145  ✓       ✕        ✓        v5.0     4,546,632             
Ecoli-MG1655.fasta.gz.k23.unik                   23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,546,632             
inter.k23.unik                                   23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     2,576,170             
union2.k23.unik                                  23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     6,872,728             
union.k23.unik                                   23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     6,872,728

# -----------------------------------------------------------------------------------------

# mapping k-mers to genome
seqkit seq Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta
g=Ecoli-IAI39.fasta
f=inter.k23.unik
# mapping k-mers back to the genome and extract successive regions/subsequences
unikmer map -g $g $f -a | more


# using bwa
# to fasta
unikmer view $f -a -o $f.fa.gz
# make index
bwa index $g; samtools faidx $g
ncpu=12
ls $f.fa.gz \
    | rush -j 1 -v ref=$g -v j=$ncpu \
        'bwa aln -o 0 -l 17 -k 0 -t {j} {ref} {} \
            | bwa samse {ref} - {} \
            | samtools view -bS > {}.bam; \
         samtools sort -T {}.tmp -@ {j} {}.bam -o {}.sorted.bam; \
         samtools index {}.sorted.bam; \
         samtools flagstat {}.sorted.bam > {}.sorted.bam.flagstat; \
         /bin/rm {}.bam '  

Support

Please open an issue to report bugs,
propose new functions or ask for help.

License

MIT License

Contributors

Showing top 1 contributor by commit count.

View all contributors on GitHub →

This article is auto-generated from shenwei356/unikmer via the GitHub API.Last fetched: 6/14/2026